Isolate 48893
DMJR-18-23-54 University of St. ThomasESKAPE Test
| Tested against ESKAPE relative | Antibiotic activity | Length of incubation | Media used |
|---|---|---|---|
| Bacillus subtilis | Yes | 24.0 hr | LB |
| Enterococcus raffinosus | Not tested | ||
| Staphylococcus epidermidis | Not tested | ||
| Escherichia coli | Not tested | ||
| Acinetobacter baylyi | Not tested | ||
| Pseudomonas putida | Not tested | ||
| Mycobacterium smegmatis | Not tested | ||
| Enterbacter aerogenes | Not tested |
Distinguishing Characteristics
I borrowed Devin Riley's isolate that he grew on LB with B. subtilis. I chose the colony labeled 18. This created a zone of inhibition approximately 2 mm in length, shown in the plate B. subtilis, starting from the unknown colony to the closest B. subtilis colony. This is a yellow-colored colony.
16S rRNA Test
Genus
PseudomonasFASTA sequence
TCACGTTACCGACAGAATAAGCACCGGCTAACTCCGCGCCAGCAGCCGCGGTAATACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTTGTTAAGTTGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCAAAACTGACAAGCTAGAGTATGGTAGAGGGTGGTGGAATTTCCTGTGTAGCGGTGAAATGCGTAGATATAGGAAGGAACACCAGTGGCGAAGGCGACCACCTGGACTGATACTGACACTGAGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTATCCCGAATTGGAACTTAATTGTACATAATDistinguishing Characteristics
A test tube was made with 2 uL of soil isolate template, 2 uL of 16sF primer, and 8 Ul of H2O. Primer used for the sequencing reaction was: CGGCCCAGACTCCTACGGGAGGCAG. This was sent to the company ACGT Inc. for the Sanger sequencing reaction. The sequence length obtained was originally 818 nt, but was cut down to 352 nt. There was a 100 nt trim at the 5' end. and a 350 nt trim at the 3' end. The 3' end was cut significantly because the base pairing was not accurate and the chromatogram peaks showed an unreliable read. The BLAST search showed a 99.38% identity to the genus Pseudomonas of the 16S gene.
Soil Sample 47603
Collected Thursday February 9, 2023
Culture Conditions 47837
Recorded Thursday February 16, 2023
Isolate 48886
Recorded Thursday March 16, 2023
Culture Conditions 47847
Recorded Thursday February 16, 2023
Isolate 48888
Recorded Thursday March 16, 2023
Culture Conditions 47841
Recorded Thursday February 16, 2023
Isolate 48897
Recorded Thursday March 16, 2023
Isolate 48889
Recorded Thursday March 16, 2023
Culture Conditions 48883
Recorded Thursday March 16, 2023
Isolate 48898
Recorded Thursday March 16, 2023
Isolate 48896
Recorded Thursday March 16, 2023
Isolate 48894
Recorded Thursday March 16, 2023
Isolate 48893
Recorded Thursday March 16, 2023
Isolate 48892
Recorded Thursday March 16, 2023