Soil Sample 276 / Culture 281 / Isolate 312
Isolate 312
SP19BIO145BV10T3+ California State University-Sacramento
Published
ESKAPE Test
Published
Recorded Wednesday, March 6, 2019
| Tested against ESKAPE relative | Antibiotic activity | Length of incubation | Media used |
|---|---|---|---|
| Bacillus subtilis | No | ||
| Enterococcus raffinosus | Yes | 48.0 hr | 10% Tryptic Soy Agar (TSA) |
| Staphylococcus epidermidis | Yes | 48.0 hr | 10% Tryptic Soy Agar (TSA) |
| Escherichia coli | No | ||
| Acinetobacter baylyi | No | ||
| Pseudomonas putida | No | ||
| Enterbacter aerogenes | No | ||
| Mycobacterium smegmatis | Not tested |
16S rRNA Test
Published
Recorded Monday, April 1, 2019
Genus
StreptomycesFASTA sequence
CGAGCTCTTCTGCAGGTACCGTCACTCTCGCTTCTTCCCTGCTGAAAGAGGTTTACAACCCGAAGGCCGTCATCCCTCACGCGGCGTCGCTGCATCAGGCTTTCGCCCATTGTGCAATATTCCCCACTGCTGCCTCCCGTAGGAGTCTGGGCCGTGTCTCAGTCCCAGTGTGGCCGGTCGCCCTCTCAGGCCGGCTACCCGTCGTCGCCTTGGTAGGCCATTACCCCACCAACAAGCTGATAGGCCGCGGGCTCATCCTTCACCGCCGGAGCTTTCCACCCACCCCCATGCGGAGGCAGGTCGTATCCGGTATTAGACCCCGTTTCCAGGGCTTGTCCCAGAGTGAAGGGCAGATTGCCCACGTGTTACTCACCCGTTCGCCACTAATCCACCCCGAAAGGCTTCATCGTTCGACTTGCATGTGTTAAGCACGCCGCCAGCGTTCGTCCTGAGCCTGTTCDistinguishing Characteristics
Antibiotic Activity of Extract
Published
Recorded Monday, May 6, 2019
Solvent used
Ethyl AaetateExperiment Description
Created lawns of the selected isolate onto two agar plates. Sliced the isolate lawns into pieces and placed them all into a flask. The flash with the isolate was then freeze. Under a fume hood, 15 mL ethyl acetate and 10 mL of deionized water was added. Two layers form, top being the ethyl acetate and bottom is the aqueous phase. The top layer is extracted containing the isolate's antibiotic. The antibiotic extract is dried down and then resuspended with 200 uL of methanol. The antibiotic extract is then spotted onto several plates each containing a different safe ESKAPE pathogen. Plates were then incubated for 48 hours at 30 degree Celsius.| Tested against ESKAPE relative | Antibiotic activity | Length of incubation | Media used |
|---|---|---|---|
| Erwinia carotovora | Yes | 48.0 hr | LB |
| Bacillus subtilis | Yes | 48.0 hr | LB |
| Enterococcus raffinosus | Yes | 48.0 hr | LB |
| Staphylococcus epidermidis | Yes | 48.0 hr | LB |
| Escherichia coli | No | ||
| Acinetobacter baylyi | No | ||
| Pseudomonas putida | No | ||
| Enterbacter aerogenes | No | ||
| Mycobacterium smegmatis | Not tested |
Associated Entries
Soil Sample 276
Collected Wednesday March 6, 2019
Published
Culture Conditions 281
Recorded Wednesday March 6, 2019
Published
Isolate 312
Recorded Wednesday March 6, 2019
Published